All about FA Files

The FA file type is primarily associated with FASTA.

FA	File extension: FA
	File type:	DNA and protein sequence file

What is a FA file?

FA files mostly belong to FASTA. FASTA file extension is the standard scientific file format used in the fields of bioinformatics and biochemistry.

• Main Use: FASTA file format was initially introduced as a part of the FASTA software package and has since been accepted as the industry norm for representing nucleotide and protein sequences. The sequence data in the FASTA file is present in a plain-text format making it easily comprehensible for the user to read the file as well. Manipulation and parsing of the FASTA sequence can be done easily done using standard text-processors and script-based programming languages such as R, Python, Perl, and Ruby. FASTA file format is capable of storing multiple nucleotide/protein sequences and is hence also known as the FASTA database format. FASTA files can be analyzed using most DNA analysis software in the market.
• Features: FASTA files usually begin with a header line that includes comments or other descriptive information related to the sequence. The first line in a FASTA file usually starts with a > symbol followed by the name of the sequence. The subsequent line contains the nucleotide or peptide sequence made up of A, T, G, and C inline with the IUPAC code. Each line can consist of a maximum of 80 characters.

How to open a FA file

You need a suitable software like FASTA to open a FA file. Without proper software you will receive a Windows message "How do you want to open this file?" or "Windows cannot open this file" or a similar Mac/iPhone/Android alert. If you cannot open your FA file correctly, try to right-click or long-press the file. Then click "Open with" and choose an application. You can also display a FA file directly in the browser:. Just drag the file onto this browser window and drop it.

Online FA Text Viewer

Choose your .fa file to view

or drag and drop it here

Online File Viewer

✈

Read our privacy guarantee in Filext’s terms and privacy policy

Please allow ads on our site

This helps us keep our servers running. Then re-upload your file to view it.

Click here to see how to disable the ad blocker for filext.com

How to extract texts from FA files or capture a screenshot to PDF, JPG, DOCX, TXT, ...

1. To do so, click the "Choose your .fa file to view" button above.
2. After your file is opened in browser,
3. click "Save as..." in the menu.
4. Then choose the file format (e.g. JPG, PDF, DOCX, TXT, ...) you want.
5. Download the converted file.

FA format details:

If you know the file format, you can also find out how to open or edit the file. The file format can be determined based on the file extension and the signature (the first few characters of a file). Nonetheless, different programs can utilize the same file extension to represent distinct file formats. Double-clicking on the file often results in an error when opening. Exact knowledge of the format is therefore important in order to solve problems occurring in files. Our evaluation of the FA files is as follows:

The FA file extension is very common and includes very many different file formats. However, the following two file formats are common:

• 20% of all FA files use the same file format, which have the signature >ref. These files are text files and can therefore be read using a text editor. FA files are between 250 bytes and 9 KB in size. The file type is very recent. Certain words are almost always found in the files, such as Homo, p13 Primary Assembly, sapiens chromosome and GRCh38.p13 Primary. Files like these have the following tags: exons and alignment.
• 9% of all FA files start with the bytes 3E 67, which are crucial for this file format. These files are text files and can therefore be read using a text editor. The average file size is 4 KB with most files being between 190 bytes and 49 KB in size. Certain words are almost always found in the files, such as Homo and sapiens. Files like these have the following tags: quow, oncorhynchus, lambda and virus.

The remaining 71% of all FA files are files with no common format, the following 50 formats can be found: GZIP, XML, UTF-8, ZIP, acaagtttgtac, lcl, ARC, atggatcctcca, GTTAATGTAGCTTAAACCTTTAAAGCAAGGCACTGAAAATGCCTAGATGA and TSAF. Files like these are sometimes linked to sequence, sapiens, homo, grch, line or chromosome. If you want to find out which format your FA file belongs to, just click on the button "Choose your .fa file to view".